ABL (9q34.12)  in normal cells     Atlas ABL  

 ABL region at UCSC

(Now better characterized BACs can be used instead)
  Primers (5' -> 3')   Clone Comment
dJ835J22    End Seq & see ABL/BCR page
dJ1146L15 see ABL/BCR page
dJ1148M22 see ABL/BCR page
dJ837P13 chimeric: 9q34+3q26
dJ957E15 chimeric: 9q34 + chr. #5
  • GGGCCCGCCTTCCGCTGTCT
  • AGTGGCCGCTCTCGCTTCTCTGCT
  • from 1st Intron, close to Exon 1b,
  • seq U07561
dJ1132H12   End Seq & see ABL/BCR page
  • TTAGAGCCAGTGAAGAAGAACG
  • CAACATATTTACAGACCCGATTTT
  • from 1st Intron (internal)
  • seq U07562
dJ913J14 see ABL/BCR page
  • GTGTGAAGCCCAAACCAAAAA
  • TCACAGAACGGATCCTCAATAAAG
  • from 1st Intron, close to Exon 1a?
  • seq U07563
dJ888H11 see ABL/BCR page

& T7 end of dJ1132H12 and SP6 end of dJ835J22 recognize the same sequence. They overlap for about 50kb

See also:

Probes telomeric to the ABL locus,
identified analyzing the contigs available at the Sanger Centre.

BAC CLONE

  STS
 CONTIG*
bA166H7   Sanger C
indeed moves to Ph chromosome in CML case		 stSG55548 (stWI-16144)(497.3 cR)(136.101 South.int.map) Chr_9ctg1820
bA92B21  Sanger C
indeed moves to Ph chromosome in CML case		 stWI-22534 (497.3 cR)(135.753 South.int.map) Chr_9ctg60
bA502C12   Sanger C
  • stSHGC-2757 #
  • stChr9-04C7 **
  • stD9S10*
Chr_9 ctg1588
bA355J12   Sanger C
  • stR16148
  • stSG4259
  • stT70609
  • stRH40425
  • stSG70274
  • stD9S10 *
  • stSG69059
Chr_9ctg1820
bA207F9   Sanger C
  • stSG31576
  • stSHGC-2757 #
  • stChr9-04C7 **
  • stD9S10 *
  • stSG55497
 
bA407L24   Sanger C
  •  WI-3929
  • stSG31464
 
* NOTE:  Contig data of this region are in progress at SC. The relative order is therefore tentative. bA407L24 seems to be telomeric since is the only probe remaining on der(9) in a case of partial translocation of ABL region to chromosome 22.

 home

 YAC

 WCP

 PCPs

 TUMORS

 ALPHOIDS

 MOUSE