|
 |
csnpatm-pcr8-1 |
UniSTS:243021 |
Primer Information |
 |
Forward primer: |
TGTTCCCCCTGTTATACCCA |
Reverse primer: |
TCAACCAGAGAAATCCAGAGG |
PCR product size: |
400 (bp), Homo sapiens |
GenBank Accession: |
G75450 |
Mapping Information |
 |
|
View all results using the Map Viewer
|
|
csnpatm-pcr8-1 |
Sequence Map: |
Chr 11 |
mv |
|
Position: |
107653119-107653518 (bp) |
|
Electronic PCR results |
 |
|
Genomic (5 of 8)[Show All Hits] |
U55708.1 |
244 .. 643 Human ataxia-telangiectasia (ATM) gene, exon 8 (682 bp)
|
AH004875.1 |
4858 .. 5257 Human ataxia-telangiectasia (ATM) gene (46258 bp)
|
U82828.1 |
32428 .. 32827 Homo sapiens ataxia telangiectasia (ATM) gene, complete cds (184490 bp)
|
AY220758.1 |
23519 .. 23918 Homo sapiens ataxia telangiectasia mutated (includes complementation groups A, C and D) (ATM) gene, partial cds (115612 bp)
|
AP001925.5 |
78786 .. 79185 Homo sapiens genomic DNA, chromosome 11 clone:RP11-241D13, complete sequence (180163 bp)
|
|
Working Draft phase 1 (from GenBank HTGS division) (1) |
AC015692.3 |
33056 .. 33455 Homo sapiens chromosome 11 clone RP11-56J3 map 11, WORKING DRAFT SEQUENCE, 38 unordered pieces (147859 bp)
|
|
Questions or Comments?
Write to the NCBI Service Desk
Disclaimer
  Privacy statement
|